python - Blasting remotely from biopython -


i'm trying remotely blast 70 200-nt sequences using biopython. i've been trying hours figure out why following python script won't work.

i can work read file contains 1 fasta using seqio.read, when try switch seqio.parse, don't in .xml save file create.

any ideas?

as side note, if knows option syntax excluding organisms results (as possible when using ncbi website, please let me know).

thanks help.

matt

from bio.blast import ncbiwww bio import seqio import tkinter.filedialog tkfd in_file=tkfd.askopenfilename() record = seqio.parse(in_file, format="fasta") out_file = tkfd.asksaveasfilename() save_file = open(out_file, "w") rec in record:   print(rec)   result_handle = ncbiwww.qblast("blastn", "nt", rec.format("fasta"))   save_file.write(result_handle.read())   result_handle.close() else:   save_file.close()

this content of in_file i'm using test file (the line formatting of file set @ 80 char, might have been lost below, also, space shown below between records not in test file):

>165613 taactgcagtgttttgtgtcgagccttttttgtgccttttttataaaggcataacgttatatttaattgaagagtttgat tctggctcagattgaacgctagcggcatgcttaacacatgcaagtcgaacggcagcgcggggagcttgctccctggcggc gagtggcggacgggtgagtaatgcgtaggaatctaccttg

>165875 gggatcttcggacctcgtgctataagatgagcctacgtcggattagcttgttggtggggtaatggcctaccaaggcgacg atccgtagctggtctgagaggacgatcagccacactgggactgagacacggcccagactcctacgggaggcagcagtggg gaatattggacaatgggggaaaccctgatccagcaatgcc

you problem library tkinter, next code works (biopython) ..... mandatory use gui ?

from bio.blast import ncbiwww bio import seqio  in_file = open("input.fasta") record = seqio.parse(in_file, format="fasta")  save_file = open("out_file.blast", "w") rec in record:   print(rec)   result_handle = ncbiwww.qblast("blastn", "nt", rec.format("fasta"))   save_file.write(result_handle.read())   result_handle.close() else:   save_file.close()

get following result:

<?xml version="1.0"?> <!doctype blastoutput public "-//ncbi//ncbi blastoutput/en" "http://www.ncbi.nlm.nih.gov/dtd/ncbi_blastoutput.dtd"> <blastoutput>   <blastoutput_program>blastn</blastoutput_program>   <blastoutput_version>blastn 2.2.31+</blastoutput_version>   <blastoutput_reference>stephen f. altschul, thomas l. madden, alejandro a. sch&amp;auml;ffer, jinghui zhang, zheng zhang, webb miller, , david j. lipman (1997), &quot;gapped blast , psi-blast: new generation of protein database search programs&quot;, nucleic acids res. 25:3389-3402.</blastoutput_reference>   <blastoutput_db>nt</blastoutput_db>   <blastoutput_query-id>query_142405</blastoutput_query-id>   <blastoutput_query-def>165613</blastoutput_query-def>   <blastoutput_query-len>200</blastoutput_query-len> ....

i tested code , find following statement wrong

record = seqio.parse(open(in_file), format="fasta")

since, in_file string y don't type file


Comments

Post a Comment

Popular posts from this blog

php - failed to open stream: HTTP request failed! HTTP/1.0 400 Bad Request -

this code i'm using find latitude , longitude of place: function coords($address){ echo $url="http://maps.googleapis.com/maps/api/geocode/json?address=".$address; $json = file_get_contents(urlencode($url)); $data = json_decode($json, true); print_r($data['results'][0]['geometry']['location']['lat']); print_r($data['results'][0]['geometry']['location']['lng']); } however returns warning: failed open stream: http request failed! http/1.0 400 bad request if use above code in simple procedure works fine not in function. note: have tried curl_init()... method produced same result? instead of encoding whole url encode address part. following code work fine $add='jamshoro phase 2'; $url="http://maps.googleapis.com/maps/api/geocode/json?address=".urlencode($add); $json = file_get_contents($url); $data = json_decode($json, true); print_r($data['r
Read more

java - How to filter a backspace keyboard input -

i have code gives message when key number pressed: txtvalueofclause.addeventfilter(keyevent.key_typed, new eventhandler<keyevent>() { @override public void handle(keyevent t) { char ar[] = t.getcharacter().tochararray(); char ch = ar[t.getcharacter().tochararray().length - 1]; if (!(ch >= '0' && ch <= '9')) { system.out.println("the char entered not number"); t.consume(); } } }); now if press on wrong button , press backspace remove it, error message. how can add backspace input if statement? i have found answer: txtvalueofclause.addeventfilter(keyevent.key_typed, new eventhandler<keyevent>() { @override public void handle(keyevent t) { char ar[] = t.getcharacter().tochararray(); char ch = ar[t.getcharacter().tochar
Read more

java - Show Soft Keyboard when EditText Appears -

i have code in android app, alert dialog , keyboard, , when dialog shown want keyboard appear. not , not sure why? here code: final alertdialog.builder alert = new alertdialog.builder(this); alert.settitle("title"); alert.setmessage("message"); final edittext input = new edittext(this); input.setinputtype(inputtype.type_class_number); alert.setview(input); input.setonfocuschangelistener(new view.onfocuschangelistener() { @override public void onfocuschange(view v, boolean hasfocus) { if (hasfocus) { log.i(tag, "in focus"); inputmethodmanager inputmethodmanager = (inputmethodmanager) getsystemservice(context.input_method_service); inputmethodmanager.showsoftinput(input, inputmethodmanager.show_implicit); } } }); but keyboard not appear though edit text in focus, , tell appear why, doesn't come up? thanks in advance.
Read more